. founded march 12, 1995 _| : _____ t r a x w e e k l y # 8 8 ______________ |___| _ _______/ /\___________________________ / ____________/ /\__\ _ _______/____/_____________________________ / / _________ \/__/ ______\ \_____________________________ / / / `_ . .~ \____\/ _ __ ___ / / / _____ . _ \ __ ___ _/__/\ / / / / /\ _ The Music Scene Newsletter __ __\__\/ _/__/ / ____/ /__\_________________________________ _____ ___ _ / /\/ /___ __________ _ ______ _ ___ \/ /\ / / /____/ \ \ / /\ / __/\ / /\ \ \ / \ /____/ / / \ / \/ /_ \___/___/ \ \_/___/ / \_/ / / \ ___\ / /_/ /______/\/ \ /______/\/ \ /_____/ // \ \ / / / \ / / \ \ \ \_\ \ \ \_\ \ //____/\____\/ / / / / / \______\/ \______\/ \_____\/ \ \ \ \ / / / / \____\/\____\ / / / / _____ _____ _____ _____ _____ _____ / / / /__/ w /\___/ /\___/ e /\___/ /\__ / l /\___/ /\____/ / / __/____/____/____/____/____/____/____/____/____/____/____/________/ / __\ \____\ e \____\ \____\ k \ ___\ \____\ y \__________/ \____\/ \____\/ \____\/ \____\/ \____\/ \____\/WW ---------------------------------------------------------------------------- | TraxWeekly Issue #88 | Release date: 14 Feb 1997 | Subscribers: 997 | ---------------------------------------------------------------------------- /-[Introduction]------------------------------------------------------------ ---------------------------------------------------------------------------/ Welcome to TraxWeekly #88. We're almost at 1000 subscribers! Again, my apologies for the break in TraxWeekly releases. I've been plagued with the usual midterms and heavy loads of work. Thank goodness there's only a few more months of school left (here in the northern hemisphere anyway =). I am looking for an assistant editor for TraxWeekly. Before anyone asks: this job is almost thankless, produces no income, and generally isn't a riot to have. You get to write introductions, make decisions on what to print or what not to print, and get friendly emails from me all the time. =) I'm really looking for someone in high school or out of school who has the time to compile the whole issue wednesday and thursday evenings...all I can offer is a hearty thanks and your name plastered all over every issue. =) Email me below. And of course we aren't dead. Check out some of the excellent music and tracking articles this issue, and I'm sure you'll be pleasantly surprised. A few large (and very good articles) sent to me aren't printed this week because I haven't the time to format them (yet). Bibby, Behemoth, and others: next week, I hope. =) Happy Valentines Day, to each and every one of you. Somewhere, out there, someone is thinking of you. Until next week! Gene Wie (Psibelius) TraxWeekly Publishing gwie@csusm.edu /-[Contents]---------------------------------------------------------------- ---------------------------------------------------------------------------/ ________ _________________________________________________________________ / ____/_/ __/ \ __/ / _____/ \ __/ __/ ___/_ < \____\ \ \\ \ \\____ __/ __/_\ \ \\____ \_____ \__ \ \ \ \\ \ \ww\ \\ \\ \ \ \ \ \_ _\________\________\\___\____\ \_____\\_______\\___\____\ \_____\_______\ Letters and Feedback 1. Letter from Snowman General Articles 2. Music Theory: A Modern Approach...............The Modsquad 3. Tracker Boringness............................Der Walfisch 4. Lameness?.....................................Ming 5. Why Stop at Your Computer?....................Coplan Closing Distribution Subscription/Contribution Information TraxWeekly Staff Sheet /-[Letters and Feedback]---------------------------------------------------- ---------------------------------------------------------------------------/ --[1. Letter from Snowman]-------------------------------------------------- From r3cgm@cdrom.comThu Jan 30 21:10:27 1997 Date: Fri, 31 Jan 97 07:06 SAT From: Christopher G Mann To: gwie@mailhost2.csusm.edu First let me congratulate you on an exceptional issue of TraxWeekly. The Throbber mail, Shaithis's response, your editorial, all excellent. : : Oh, major congrats to the DN reviewing staff. For those of you who : subscribe to DemoNews, more detailed comments are starting to appear : with the standard "*" reviews, thanks to Phoenix. : In the SDD data format we use on the Hornet Archive, there is a "description" field available for all files. When the format was first created, this was to be used primarily for files in /code (where descriptions would prove invaluable... not that they wouldn't elsewhere, but it seemed particularly useful with /code). So Kneebiter goes and reviews a whole buch of /code, making excellent use of descriptions. I sat down a week or two later with a directory full of music disks to review. It was then that I realized it wasn't really that time consuming to jot down a few notes here and there for music. Now GD had written this nifty little proggy called SDD Edit a while back. It took the task of entering error-prone reviewer data and made data entry reliable and fun (as working with SDDs should be). However, at the time GD wrote the program his knowledge of dynamic memory management was still a bit ripe and so reviewer-entered descriptions could only be 40 characters long. This wasn't a big deal since we were only using the descriptions for /code. Kneebiter can write flawless raw SDDs without the use of SDD Edit. People actually took notice and the response was good. So we realized just how nifty descriptions could be and I asked GD for an SDD Edit rewrite. A rewrite that would eliminate the 40 character limitation. He's doing this now. Soon the power of SDD descriptions will be in the hands of music reviewers, where I am confident they will wield them with style and maturity. We are now going to be using descriptions more often on the Hornet Archive. Christopher G. Mann - r3cgm@hornet.org (ftp|www).cdrom.com - Webmaster & Technical Support, Walnut Creek CDROM (ftp|www).hornet.org/pub/demos - Hornet Archive Maintainer ---------------------------------------------------------------------------- /-[General Articles]-------------------------------------------------------- ---------------------------------------------------------------------------/ --[2. Music Theory: A Modern Approach]----------------------[The ModSquad]-- Music Theory: A Modern Approach To Perfecting An Old Art, and Learning How To Better Yourself, and What You Track. by Finrez, Radio Shock, Neon Hunter modsquad@juno.com This is the second article in our second theory series. We don't know how long series will be, but our quick outline of topics that need to be covered shows a length of perhaps 6 parts. This installment, we will cover Mexican 909 and Accordion, Musical Scales, Musical DNA, MIDI Interfaces, Juggling Raves, What makes Wave and Necros good, and Drums. vvv- groove v v vvv - more groove -=-=---=--=-=------[ MY ORTHODONTIST ]------=-=---=------- "Yeah, yeah, I'm licking your balls." _CB4_ --Cell Block 4 I realized, that since my orthodontists office is in mexico, he always plays mexican music.. actually, it is like mexican dance music.. I always notice the 9O9 drum beets playing in the backackbackground (groove). I can really hear those CCO CCO CCO hihat loops when hes using machinery and I can only hear trebbly sounds (you know, that famous techno hihat riff?).. but the FUNNY THING IS, when you're hearing some lady singing something like, "yo soy yodando por ti" or something, and then, it'll get maybe 40 bpm faster, and it'll turn bright.. but then it hits. an accordian solo. the accordian solo is playing, it actually sounds cool.. but the best thing is, the 9O9 beet starts playing along with it! now can you beleive this?.. they also do the same thing with those famous trumpet/tuba solos! you know, with all of that "gumbah" music or whatever its called, that those gangstahs always play? its just like that.. but its a techno version. next time you track a tune, think about this. think about songs like remixes of "children" by robert miles.. a piano/guitar riff with freakin breakbeat loops in it! this sounds rad! why should the mexicans do it? they do! it rocks! now next time you track somethign like this, do a cover of firestarter, except take the chords and the vocals.. ("i'm a firestarter.. if you want fire, goto hell. theres plenty there.") and then add some kickass drumloops.. remember these steps when doing so: 1) try it. 2) apply it. 3) test it. 4) up it (cdrom.com) go ahead, make some 16 disk all-mixto (mixto being the mix of whatever with techno) music pack, and upload it to cdrom.com.. that'll give those damned hornet raters (i think the only one is jtown), something to groove to. write some groovy funk shit!! groove to shitty funk! --------------[ MUSICAL DNA ]---------------- "Would you like to study Philosophy?" _SAD_BUT_NEW_ --The Orb One day a few years ago in a biology class I saw a tv show where there was a band that played notes signifying a strand of DNA. There was a piano, with four notes, one for Acetate, one for Guatelamaline, one for Caline, and one for Theremine. Or whatever the four molecules were. Anyways, the piano would play four notes, then the strings would play a chord that was told by the different notes. Who could've imagined it? Well, I know I can tell now! But you could even come up with your own techniques, just like these people did. Heres what I would do though: Get a sample of your own DNA and take it to a lab. When they give you back your trillions of DNA strands in ACGT strings, you will have enough material to make an original song every time! And it will be completely unique! Only you have your DNA! So take A make it A, C make it C, and G make it G, and T maybe D# or something. Then once you've made four notes, put them all together and make a chord. Once you've played four chords, put all THOSE together. Heres an example: DNA STRAND: ACGTGATCGATGTGCTGATGTTCGCTCGTAGTCCGTAGCTCGTAGCTG Notes: Piano ACGT GATC GATG TGCT GATG TTCG CTCG TAGT CCGT AGCT CGTA GCTG A G G T G T C T C A C G String C A A G A T T A C G G C notes G T T C T C C G G C T T T C G T G G G T T T A G AG GG CC Brass CA AT CT chords GT TC GA TC GG TG GT TA AC AG TG GT that's actually a clip from my DNA and a tune I tracked based on it. I know it doesn't seem to follow the style of lead progressions, but take a closer look: ACGTGATCGATGTGCTGATGTTCGCTCGTAGTCCGTAGCTCGTAGCTG A* * * * * * * piano C * * * * * * ** * * * G * * * * * * * * * * * * * * * T * * * * * * ** * * * * * * * string A * * * * * * * * * C * * * * * * * * * G * * * * * * * * * T * * * * * * * * * The pattern of asterisks is obvious. For every one of the below ones there is at least one in the previous four in the top chart. So you can get music from your genes. Who knew? -------------[ MIDI INTERFACES ]-------------- "Would you like to study Technology?" _SAD_BUT_NEW_ --William Orbit Everyone knows that you can compose any sort of music in a tracker, but don't you think that if you could plug your keyboard into a tracker it would be easy to make masterpieces, especially if you could play the piano. Of course, to play the piano takes years of practice. And then you can track so much better! To make the connection between your midi keyboard and tracker program takes massive skillz, so its best left to a guru. If you have a guru nearby, got to him. Otherwise, I am working on a patch to where I can patch your midi cable directly into the soundcard and it works with Modedit. Its something like this: 1. Get the midi port 2. Read from the midi port 3. Translate the number you get into a note 4. Put that note in the keyboard buffer as if you typed it. 5. Repeat step 2 Then the tracker will think you typed the note when you really played it. Anyways, once you have it in, try the following: Press the "tracking" key on your tracker and set up a bunch of blank orders. Now press the "record" button and play the keyboard. Guess what: the notes show up in the tracker! Isn't that the coolest thing you ever saw? I know it has revolutionized my tracking style. It can do the same for you. ----[ SCALES, BUT WHERE'S THE DRAGON? ]------ "WELL!?? YOU BASTERD TELL ME OR I'LL KICK YOUR ASS!" _SAD_BUT_NEW_ --Orbit c5-f5-g#5-a#5-c6-f6-g#6-a#6 - C Fucked Minor Scale (not majorly fucked) d5-e5-f#5-g#5-c6-a6-f#6-g#6 - C Fucked Major Scale (damn this is fucked) c5-f5-g#5-c#5-f6-g6-c#7-f#7 - D Grace Major Scale c5-d5-e5-g5-g#5-f#6-c#7-e#7 - E Blues scale -------[ WAVE AND NECROS.. WAT MAKES THEM GOOD? ]--------- "Technology or Philosophy?!? Pick one, God Damn you!" _SAD_BUT_NEW_ --Roy Orbison first off, I'll have you know that I dont expect my views to match those of everyone else out there, so, dont mail us with flames :).. I think that necros and wave are both kickass musicwriters, and I doubt my opinions will ever change :) I'm sure all, if not, many of you have wondered about wave, and necros. what differenciates the two? why are they sooo good?.. i'd have to say.. groove, and emotion. if you ever listen to a wave tune, you wanna jump up and down and dance and shout and whistle, hollar, groove, and run, and skip and wank, err.. well.. you get the point. he writes damn groovy tunes! then again, you listen to a necros tune,and you remember shit like when you were 5, swining on the schools swingset, and riding a carosel at some rip-off, socialist driven, commy-pig run park, but that doesnt matter. its emotional shit (most of the time).. so, how can you do it?.. you probably cant, so dont try. anyways, I personally dont think that the two are better than each other, but, they're just on the opposite sides of the spectrum, wave isnt cheeze, its just so good you wish you could call your music "wave cheeze", but, you cant, and necros isnt experimental bullshit, its good stuff. -------------[ JUGGLING RAVES ]----------------- "Oh I like to juggle juggle juggle juggle I like to juggle all day." _HIGHER_STATE_OF_UNCONCIOUSNESS_ --Josh Wank Its the newest rage in the techno seen. Juggling raves. The years go by and new forms come and go, but it looks like this one is staying. Ever go to a rave and see people juggling oranges instead of dancing? Thats the new thing. People like to juggle to techno. Its easy to learn; a hell of a lot easier than dancing. Just take some fruit out of your drawer. Don't trust yourself to be able to juggle knives or glass balls right from the start. Now throw them all up in the air. Let them drop to the ground. This is so you can learn to deal with failure. Try it again and again. Resist the temptation to grab them. This is to build self control. Now throw them all up in the air and catch them! Got it! Cool! If not, you've got a lot of work ahead of you. Ok, try throwing one. Now two. Now three. Can you catch three? Cool, now you can go on to knives! Try it out! And go to all the juggling raves you can find! ---------------[ DRUMS ]------------------- "Bing bang boom bosh te tshhhh." _Second_Best_Drum_Loop_ --Neon Hunter I was thinking about the groove interactivity chapter and now I realize that it needs more. Like more about drums. Heres how you can do cool drums: First lets look at the three classic drumbeats: 1. BHHHSHHHBHHHSHHSBHHHSHBHHHBHSHHSBHHHSHHHBHHHSHHSBHHHSHBHHHBHSSSS 2. BHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRHBHRH 3. BHHHSHBSBSBHSHSSBHHHSHBSBSBHSHHHBHHHSHBSBSBHSHSSBHHHSHBSBSBHSHSS With the Bs being bassdrums, S being snaredrums, the H being hihats, R being ridecymbals Of course, it sounds stupid all in one channel, so lets spread them out: 1. B B B B B B B B B B HHH HHH HHH HH HHH H HHH H HH HHH HHH HHH HH HHH H HHH H S S S S S S S S S S SSSS 2. B B B B B B B B B B B B B B B B H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H R R R R R R R R R R R R R R R R 3. B B B B B B B B B B B B B B B B HHH H H H HHH H H HHH HHH H H H HHH H H H S S S S SS S S S S S S S S SS S S S S SS Now knowing the scene these days, they'll never let you get away with these beats, so you have to change them around in sneaky ways to use them but they are still some of the best beats around. Try different things. Experiment. Reverse them, change the hihat to a crash cymbal or something. Swap the bass and snare. Mix in bits of other beats to add spice. Your song will thank you for it. ------------------------------ That was the second installment of our second music theory series of articles. If you want to contact us, our email address is at the top and bottom of the file. Love, Finrez, Radio Shock, and Neon Hunter modsquad@juno.com ---------------------------------------------------------------------------- --[3. Trackers Boringness or DO NOT COPY !!]----------------[Der Walfisch]-- Hi, I'm a tuner about 4 years and I read traxweekly as I get it. One interesting point on the whole tracking world to me is the so-called "lack of professionality" by the tracks or the tuners, maybe of the compositioning, maybe of the hardware they're using, maybe of the samples, whether ripped or not, maybe of the style they're playing....seems like there is always a reason why tracking is not professional. I think the main reason for this is the lack of reasons for using tracked music. The very best tracked music in my ears is just demo music, because it was made for filling a function : make a demo sound. Mostly the demos are as good as their soundtrack. If the demo is weird, the sound is weird too. And not to compare with anything out of the demo world. If the sound is better than the demo - just sounding like direct cd output - it becomes suspicious. Every good jazz band becomes boring if they're trying to play techno. Every rapping MC which is too near at the original is boring too. Listen to Warren G's "Regulator" - thats boring! Listen to Ice Cube's "When will they shoot?" - thats c00L !! Ice Cube is a creator, and every tracker may better realize himself as a creator too. Quality will come over time. Here's my opinion on -what a tracker is: What can you do if you can't play any instrument and think you will never learn one? Because you're finger-lame or the only instrument you could play is the one you DONT WANT to play ? This is the main reason why I'm a tracker, because I always wanted to play ANY instrument, I always wanted to compose or maybe to sing, but playing is a very physical thing, and I never got much luck in learning such things. I've heard a lot of music, and I always did imagine if I could play ANY instrument, what would I do? That was what I did when I first got my fingers on a tracker. Once after making my very first tunes, I felt big respect to any musician existing, because I saw the work behind and now I also could think their way . On my opinion, a tracker is something additional to musicians and DJ's. He's both but nothing of both. Like a good DJ catches sounds and mix it to something own special, a tracker catches samples and does something totally new. If he wants to! Unfortunately some tuners specializes theirselves in doing -"realistic" tunes which I found mostly BORING! I may except f.e.Necros, because he's not only a good musician but also a good composer - which is NOT the same. Tracked music is always a little bit more weak than the original. Making realistic tunes is like german rap music - mostly it sucks! German rappers may have their fans, maybe they're not that much bad, but they're nothing compared to any bad westcoast rapper ! On the other side, no black rapper can look that c00L that Kraftwerk looks like ! Kraftwerk did what the most german musicians did not - making their own music which is best on them ! Have you ever heard german swing?? If not, then you're a very lucky guy indeed!! Every "realistic" tune is a little bit like german swing, every jazz-tune is off course not "tracked jazz" but tracked pseudo-jazz. I gonna have respect to the work of those tuners, but they may ask theirselves if this is worth it! Plagiatism is not very c00L.... By the way, talking about plagiatism: Self-plagiatism is what I mostly need to critizise on - music discs but I still may except Necros. His "Progression" music disc was not only perfect sound, also every tune got a different sound! Mostly music discs features collected modules of the composer, who mostly got his "style", which means mostly the same samples or the same song principe or the same song theme in every tune is used. These trackers may be damn c00L, but only on one tune, which concept will be repeated ten times. Maybe I'm the only one who think this is boring, dontcare how good the tracker is. But if you're unable to do a fast, a slow, an intensive and a loose tune on one music disc, you're unable to do a music disc anyway. Big Respects to everyone who did a music disc that way (I haven't heard that much good music discs yet...) Maybe the most specialized "realistic" veteran tuners may not agree with me and will continue doing their stuff, which is ok. Maybe these c00L stylish tuners may never try to leave their style - what for?? But every beginning tuner may think about that ! Every song becomes boring with the time ! All 3 points have one message: DONT TRY TO COPY !! Every agrees and disagrees please send to me... Der Walfisch / E.S.C. (Der_Walfisch@outside.in-berlin.de) ---------------------------------------------------------------------------- --[4. Why Stop At Your Computer?]---------------------------------[Coplan]-- If you are any bit like myself, and many other participants in the demoscene, you are addicted to tracked music. In fact, as I write this article, I have "Dirt" by Khyron playing in the background. Whenever I have a chance, I like to listen to as much tracked music as I can. Don't get me wrong, I still listen to my favorite Tori Amos and Edwin Collins albums. But I often find myself sitting at my computer staring deep into the pattern data scrolling across my screen. Unfortunately, my computer is a desktop model, and I can't take it with me everywhere I go. Besides, I would imagine it would be rude if I were to pull out my laptop and start playing "Dust to Dust" (Leviathan) during a lecture. So what do I do? I record them. If you are thinking right now "what good will a WAV file do if you still don't have your computer with you," then you are too deeply involved in the computer age. I mean record the songs onto a simple audio cassette, a matter of a few bucks in price. For some people, recording your songs may be more difficult than for others. I personally have my computer hooked directly into my stereo system. So recording my tracked music collection onto audio cassettes wasn't a difficult task. However, many people don't have this type of setup. I would be willing to bet that more people don't have their computer hooked into their stereo system. But don't give up! You are a bright person (you learned tracking didn't you?). I am sure you can figure out an easy way to connect your soundcard to your stereo system. Even if you connect it to a box radio with tape deck. I personally used a head-phone extension cord* and a Y-cable (splitter cable) with RCA input plugs. I plugged the RCA input into my TV/VCR** input on my stereo. Guess what? That's it. Nothing fancy, and it only cost me a total of $12.00 (US). Now that you have your soundcard hooked up to your stereo, start recording. It's really as simple as pressing the record button on your stereo (with a fresh blank tape of course), and playing a song. Each stereo system is different, but most often, you will have to switch to the option you plugged your computer into to record from it (this should be obvious to most people). Before you go off and start recording, I have one recommendation. Try to use the tracking program that the song was tracked in whenever possible. This will assure you that you are recording the song in the quality that the tracker intended. So, now you have your audio tapes of your collection, or at least your favorite songs. What do you do with the tapes? If you haven't thought of a million uses yet, I can give you a few ideas. Listen to them in the car on your way to work or school. Take a walk-man with you and listen to it as you do your routine, whatever it may be. I personally like to study to it when I am at school. One benefit of tracked music that I have found is that it typically does not have lyrics. So, there's nothing to sing along to, and in turn, nothing to distract me from my studying. I have even gotten a few people interested in tracking by playing my tapes for them. One friend of mine wrote several songs for his girlfriend and recorded them onto audio cassettes because she doesn't have a computer (unfortunately, people like that do still exist!!!). There are probably zillions more uses that I haven't come across yet. At first, I wasn't going to write this article. I thought that everyone did this, or at least something similar. But upon talking to some fellow tracking friends of mine, I discovered that they hadn't even thought of this. So, I figured that there must be a handful of people out there that also haven't thought of this. It's a great art form, don't let it sit on your computer. Take it with you. TIPS (as starred appropriately above): * - If you want stereo sound on your audio cassette, make sure you have a stereo cable. The easiest way to check this is to look at the jack. If it has one rubber band around it, it's a mono cable. If it has two, that's a stereo cable. ** - Some stereo systems have two sets of inputs. If you have one marked PHONO or PHONOGRAPH, avoid it if at all possible. It is set up for a record player. Often that set of inputs doesn't have as high a quality of sound as something like the TV/VCR inputs. Comments, ideas...e-mail me. Coplan coplan@thunder.ocis.temple.edu ---------------------------------------------------------------------------- --[5. "Whaddaya mean Lame? Noone is lame?"]-------------------------[Ming]-- by MING / DiSC, Scrape, WMR Email: mattias.inghe@mailbox.swipnet.se --Reply to Eraīs "An Outsider's Outlook Into The Demoscene" in TW#86-- As the outsider to The Scene I until recently (about a year ago) was, I have to protest against the narrownindness reflected in the article. What is described is not the scene I have come to know and love, this wonderful meltingpot of styles, ideas and influences. Instead, someone says "This is how it should or not should sound. Those styles thou should not work with, only because what you make is tracked modules, and not commercial." Itīs like saying to a dude with a pen: "Thou MUST write poems, thou SHALL NOT write anything else." Pretty naive, eh? > It's when you try to compose something original and it winds up >sounding like the usual commercial breakbeat (and worse still, everyone >you play it for notices), that massive rejection from real-worlders comes >into play (unless you acknowledge it to be a cover track). Funny, the only rejection from the so called real-life listeners Iīve recieved so far have been reactions to songs that have been simply bad, period. Regardless of style, commercial or underground (Ooh, I hate to cathegorize this way, music is music, and nothing else.) good, enjoyable songs are equally appretiated. >Now, when a >musician simply emulates the style of another tracker, then that clearly >demostrates a lack of originality and creativity on their part. Lame! :-/ If a composer wants to do music in a certain style, is he really worth the title Lamer just because he donīt invent his own genre or style? Composing is as all other cultural activities a creative artform, and noone can direct another artists influences or style. If a song is made in a style resembling another composer I frankly donīt give a damn. I listen to the musical qualities, and not to the coolness factor. >The whole point to listening to tracked music (in my opinion) >is mainly to get away from the crap we hear on the radio, in concerts, and >on tapes/CDs. If one truly wanted to hear commercial, mainstream, >real-world music, wouldn't they just stick to the traditional medium of >radio/TV or tapes/CDs? The one thing that fascinated me most with the scene was the attitude that nothing was wrong, everything was accepted. FM-rock, hilbillie-country or underground, as long as youīre openmided and not commited to elitism. Why would mainstream music not fit in the sceneīs structure? As I said, what- ever label you put on the music you hear, it is still music. The tracking scene of today is a great marketplace(?) where all kinds of music can be released, discussed and listened to without prejudice. >Composing is a process and sampling is part of that process. Correction: Composing and Sampling are both parts of the process called Tracking. Composing CAN be done with a pen and a notesheet too, you know. >The idea I am conveying here is REALISM. With >16-bit sample capabilities of IT and FT2 and the CD-Audio ripping utils >out there, maybe trackers can achieve greater realism in their music and >we can hear cover songs that sound less artificial, less synthesized in >the future. Amen. The quality of a tracked tune (if conducted with skill) could nowadays be fully compareable with any syntesized music on disc. Letīs just hope that pepole understands that they posess powerful (and cheep :) tools for making professional music, and not just something to make bleepy demo tunes with. (Nothing wrong with that tough. Itīs still music. :D) > It's things like seeing repetitive music (STOP REUSING THE EXACT >SAME PATTERN 4 OR MORE TIMES!!! ARGH!!!) that define my pet peeve... >please don't drag out a song any longer than it needs to be. The length of >a demo, pic, or song is simply measured by the imagination of its creator. Again, that is what is called artistic freedom. If the effect the creator of a tune wishes to achieve is repetition, Iīd say he is free to reuse as many pattern he want. But then maybe noone likes the tune, but thatīs another story. Then weīre into success and popularity , an often tedious subject, which could end up with the statement that Mainsteam Is Better, Because Itīs More Popular. And who agrees with that? At least not I. :) And what is the lenght of a pic? ;) >The Hornet Team, despite >criticism for its lack of objectivity in ratings (hey, they're only >human!) are doing the demoscene a great service but I feel that they could >improve their objectivity if their ratings were more detailed. Or if they skipped the ratings. I have heard glorious * songs and totally crap rated up to ****. But this have geen debated back and forth so much that I guess there is nothing more to say. So I wonīt. Anyway, Iīve said what I wanted to say here, that this stupid labeling into Mainstream and Underground, this talk about the lameness of copying styles and lameness or nonlameness of certain composing methods is just plain bullshit. Noone is lame, except those who claims that other are. (Did that line make ME lame then? :D) Keep doing whatever music you want to and donīt let the norm police catch you. Unfortunately, the scene have somewhat turned rigid lately because of exactly this. Some pepole, quite a few, with great influence over the lot have become so obsessed with this Underground thing that the movement have been suffering. Less openminded pepole, growing elitism and a general fear of being uncool is IMO the biggest threat of this thing we call the Scene. Anyway, Iīm not gonna hang out any names here, but if what I just said pisses you off, youīre probably one of them. ]>8*D= Now Iīm done yodeling. :) Iīd appretiate feedback and continued public debate on this, since I really think itīs important. hugz MING ---------------------------------------------------------------------------- /-[Closing]----------------------------------------------------------------- ---------------------------------------------------------------------------/ TraxWeekly is available via FTP from: ftp.cdrom.com /demos/incoming/info (new issues) ftp.cdrom.com /demos/info/traxweek/1995/ (back issues) /demos/info/traxweek/1996/ (back issues) /demos/info/traxweek/1997/ (back issues) TraxWeekly W3 is under development by Pinion (pinion@netcom.com) To subscribe, send mail to: listserver@unseen.aztec.co.za and put in the message body: subscribe trax-weekly [name] (NOT address) To unsubscribe, mail same and: unsubscribe trax-weekly (in message body) Contributions for TraxWeekly must be formatted for *76* columns, must have a space preceding each line, and have some measure of journalistic value. Please try to avoid the use of high ascii characters, profanity, and above all: use your common sense. Contributions should be mailed as plain ascii text or filemailed to: gwie@csusm.edu before 11:00pm PST (North America) every Wednesday. TraxWeekly is usually released over the listserver and ftp.cdrom.com every Thursday or Friday at 10:00am PST (North America). TraxWeekly does not discriminate based on age, gender, race, political or religious statures and standpoints. The staff can be reached at the following: Editor: Psibelius (Gene Wie)..............gwie@csusm.edu Staff: Atlantic (Barry Freeman)..........atlantic@arcos.org Benjamin Krause...................orogork@cs.tu-berlin.de Fred (Fred Fredricks).............fred@paracom.com Kal Zakath (John Townsend)........jtownsen@sescva.esc.edu Kleitus (Seth Katzman)............katzms@rpi.edu Mage (Glen Dwayne Warner).........gdwarner@vinson.navy.mil gdwarner@ricochet.net Graphic Contributors: Cruel Creator . Stezotehic . Squidgalator2 . White Wizard TraxWeekly is a HORNET affiliation. Copyright (c)1995,1996,1997 - TraxWeekly Publishing, All Rights Reserved. /-[END]--------------------------------------------------------------------- ---------------------------------------------------------------------------/ :: ::: : . ..... ..............................:::.................:.... ::: : :::: : .::::. .:::::.:::. ..:::: :::: : :: :: ::: .:: :: :: WW:::: : ::. :: ::: .:: :: .:: :::: : :::.::. ::: .:: .:: .:::::... :: :::.. ... ..: ... ..:::::::::::::::: .:: .::::::: :::::::: ::::::.. ::: ::: ::: : until next week! =) .. ... .. ....... ............... .................:..... .. . :